Abhd4 Knockout 3T3-L1 Stable Cell Line (Clone L16)

Description

The Abhd4 Knockout 3T3-L1 Stable Cell Line Clone L16 is a murine preadipocyte cell line engineered using CRISPR/Cas9 to disrupt the Abhd4 gene, which encodes Abhydrolase Domain Containing 4 ABHD4 an enzyme implicated in phospholipid metabolism and lipid signaling. This cell line provides a powerful tool for studying ABHD4s role in adipogenesis and metabolic regulation. Genome editing was performed using a single guide RNA sgRNA with the sequence TTATGTATCCCTCCCAAACC, specifically designed to target exon 3 of the Abhd4 gene. Clone L16 was selected based on confirmed biallelic knockout at the DNA level and loss of ABHD4 protein expression, as verified by Western blot Seramur, Mary E et al. 2023 .